Русский English

Нехорошкина М.О., Кариди А.В., Бушуева О.Ю., Лазарев К.Ю., Голубцов В.И.

Определение этиологических факторов, детерминирующих клинический полиморфизм врождённых расщелин губы и/или нёба у детей Краснодарского края

Кубанский государственный медицинский университет, г. Краснодар

Курский государственный медицинский университет

В нозологическом спектре врождённых пороков развития (ВПР) человека врождённые расщелины губы и/или нёба (ВРГ и/или Н) являются наиболее частыми. При этом выявлены существенные различия частоты этой патологии в отдельных популяциях [3,6]. По данным Всемирной организации здравоохранения частота рождаемости детей с ВРГ и/или Н составляет около 1:1000 [5].

Около 20% пороков развития обусловлены генными мутациями, 10% хромосомными, а 70% – мультифакториальное происхождение [4]. Изолированные ВРГ и/или Н имеют преимущественно многофакторный характер, где генетические факторы являются предрасполагающими к их формированию [11]. Установлено, что формирование этой патологии происходит в раннем эмбриогенезе при наличии в родительских половых клетках мутантных генов либо геномной или хромосомной мутации (генетический фактор), а также в результате воздействия внешнесредовых факторов тератогенеза, что нарушает гистоорганогенез челюстно-лицевого аппарата эмбриона. Следовательно, врожденную расщелину верхней губы и нёба можно рассматривать, как индикатор присутствия и воздействия мутагенных и/или тератогенных факторов в среде обитания человека [1].

Независимо от этиологического фактора ВРГ и/или Н проявляется с первых часов жизни новорожденного не только морфологическими, но и функциональными нарушениями актов приёма пищи и дыхания, а в последующем часто задержкой психосоматического развития. Практически всем больным с этой патологией проводится хирургическая (косметическая) коррекция, а также послеоперационная реабилитация в специализированных ЛПУ. Однако, вопрос о возможности повторного рождения больного ребёнка в семье, отягощенной этой патологией, остаётся до выяснения этиологического фактора, обусловившего порок в каждом конкретном случае.

Однако, актуальным для решения вопроса о возможности повторного рождения больного ребёнка в семье, отягощенной этой патологией, является поиск этиологического фактора, обусловившего порок в каждом конкретном случае.

Цель исследования: оценить роль генетических факторов, детерминирующих клинический полиморфизм ВРГ и /или Н у детей, родившихся в Краснодарском крае (Юг России) за последние 17 лет.

Материал и методы исследования. Объектом исследования являлись 1024 больных детей с ВРГ и/или Н, родившихся в Краснодарском крае за период 1996-2012 г.

Проанализированы регистрационные карты и истории болезни всех больных с ВРГ и/или Н, из которых получена первичная генеалогическая информация и другие сведения о больных. При выявлении данных об аналогичной патологии у родителей или родственников больного, а так же наличии у больных с ВРГ и/или Н другой врождённой патологии они осматривались нами лично. При этом определялся клинический вариант патологии, собирался углубленный генеалогический анамнез, уточнялся клинический диагноз и намечался план необходимого обследования больных. Таким образом нами осмотрено и дополнительно обследовано 810 больных.

Цитогенетическое исследование (кариотипирование) проведено у 247 больных. В группу обследованных вошли больные, имеющие родственников с аналогичными признаками у членов семьи, а так же пробанды с множественными ВПР. Использована стандартная методика 72-х часовой культуры лимфоцитов периферической крови (около 1 мл) в среде RPMI. Дифференцированное окрашивание хромосом проводили методом С и G. Просмотр метафаз выполнен под микроскопом AXIO Scope a1 при увеличении х1000. Анализировали 30- 50 метафаз от каждого больного.

Молекулярно - генетическое исследование проведено у 102 больных, у которых присутствовали только ВРГ и/или Н (изолированный порок развития). В качестве группы контроля были взяты родители исследуемых больных - 153 человека (родительский контроль).

Выделение ДНК производили из крови больных (5 мл.) стандартным методом фенольно-хлороформной экстракции [9]. Анализ полиморфизма гена ABCB1 выполняли методом полимеразной цепной реакции (ПЦР) с соответствующей верификацией в режиме реального времени в амплификаторе CFX96, Bio-rad, с использованием ДНК-полимеразы (производства фирмы «Сибэнзим») и локусспецифических олигонуклеотидных праймеров и зондов («Синтол», Россия):

F: 5’- ctgtttgactgcagcattgct -3’

R: 5’- atgtatgttggcctcctttgct -3’

5’-FAM-ccctcac(a)atctctt-RTQ1-3’

5’-ROX-ccctcac(g)atctctt-BHQ2-3’

При проведении ПЦР выполнялось 40 циклов. Каждый цикл амплификации включал 3 этапа, протекающие при различных температурных режимах: 1) денатурация - нагревание двухцепочечной ДНК-матрицы до 95°C, время стадии 1,5 мин.; 2) отжиг - температура подбиралась равной температуре плавления праймеров, что составило 51,3ºС, время стадии отжига — 1 мин.; 3) элонгация при температуре 95С в течение 15 сек. Анализ полученных результатов оценивали по графическому распределению соответствующих аллелей.

Для оценки соответствия распределений наблюдаемых генотипов и ожидаемым их значениям при равновесии уравнения Харди-Вайнберга и для сравнения распределений частот генотипов и аллелей в группах больных и здоровых использовали критерий χ2 Пирсона [2]. Для сравнения частот аллелей и генотипов между различными группами использовали критерий χ2 с поправкой Йетса на непрерывность [8,10] . Различия рассматривали как достоверные при уровнях значимости р<0,05. Об ассоциации генотипов с предрасположенностью к заболеванию судили по величине отношения шансов (odds ratio, OR) с 95% доверительным интервалом (CI). Статистическая обработка данных проводилась с использованием программных пакетов Statisticа 6.0 («StatSoft», США).

Результаты и их обсуждение. При клиническом осмотре 810 больных нами установлено, что у 465 (57,4%) детей расщелина губы и/или нёба являлись изолированным ВПР, а у 345 (42,6%) кроме ВРГ и/или Н присутствовали и другие врождённые патологические признаки, что соответствует множественным ВПР.

Клинико-генеалогический анализ, проведенный в семьях больных, позволил установить аналогичную патологию у 41(5,06%) родственников пробандов, в том числе: у 4-х больных – аналогичная патология была выявлена у одного из родителей, у 22 – врожденные пороки были диагностированы у сибсов пробанда, а у 11 - среди родственников II и III степени родства. У остальных 769 больных данный ВПР оценен как спорадический вариант патологии.

Таким образом, по результатам клинического обследования у 98 (12,1%) больных с МВПР были диагностированы наследственные синдромы. Нозологический спектр моногенных наследственных синдромов представлен в табл. 1.

Таблица 1. Нозологический спектр моногенных наследственных синдромов с признаком врождённой расщелины губы и нёба на территории Краснодарского края

Таблица 1. Нозологический спектр моногенных наследственных синдромов с признаком врождённой расщелины губы и нёба на территории Краснодарского края

Примечание: АД - аутосомно-доминантный; АР - аутосомно-рецессивный

Таблица 2. Структура и частота хромосомной патологии у больных с ВРГ и/или Н в Краснодарском крае

Таблица 2. Структура и частота хромосомной патологии у больных с ВРГ и/или Н в Краснодарском крае

Цитогенетический анализ проведён у 247 больных, из которых у 50 (20,24 %) диагностирована хромосомная патология, обусловленная анеуплоидиями и аберрациями хромосом.

Из представленных в табл. 2 данных видно, что наибольший удельный вес в структуре хромосомной патологии приходится на синдромы Эдвардса (1,8%), Патау (1,3%), Лежена (1,0%).

Молекулярно-генетический анализ включал генотипирование полиморфного варианта 3435 C/T (26 экзон) гена ABCB1. Генотипирование проведено у 102 больных детей русской этнической группы у которых ВРГ и/или Н диагностирован как изолированный порок развития (56,1% -мужского и 43,9% - женского пола). Результаты молекулярно-генетического анализа представлены в табл. 3.

Tаблица 3. Распределение аллелей и генотипов полиморфизма 3435 C/T (26 экзон) гена ABCB1 у пациентов с врождённой расщелиной губы и/или нёба и здоровых лиц (контроль)

Tаблица 3. Распределение аллелей и генотипов полиморфизма 3435 C/T (26 экзон) гена ABCB1 у пациентов с врождённой расщелиной губы и/или нёба и здоровых лиц (контроль)

Примечания: 1абсолютное число и процент лиц с исследуемым генотипом; 2Хи-квадрат и p-значения (df=1); 3отношение шансов с 95% доверительными интервалами; *вариантные аллели (мутации) представлены в нижних ячейках соответствующих ДНК-маркеров

Распределение частот генотипов изучаемого полиморфного варианта гена АВСВ1 проводилось раздельно в контрольной группе и в группе больных и соответствовало нормальному распределению уравнения Харди-Вайнберга в обоих группах.

Сравнительный анализ частот аллелей в обобщённой группе больных с ВРН и ВРГН не выявил статистически достоверных различий. Мы также не обнаружили ассоциаций аллелей и генотипов исследуемого ДНК-маркера с риском развития ВРН. Однако, в группе больных с ВРГ отмечалась тенденция к накоплению мутантного аллеля Т в группе больных по сравнению с контрольной группой (р=0,06, OR=1,94, 95% Cl=0,98- 3,87). Частота гомозигот по дикому аллелю в группе больных ВРГ составила 10,5% и встречалась в три раза реже по сравнению с контролем (30,7%); при этом различия приближались к уровню статистически значимых (р=0,07, OR=3,77, 95% Cl=0,84-1,97).

При сопоставлении частот генотипов в группе больных с ВРГ и/или Н и в группе здоровых статистических достоверных различий нами обнаружено не было, как в обобщенной группе больных с ВРГ и/или Н, так и при анализе отдельных нозологических форм.

Выводы В результате проведенного нами анализа можно сделать вывод о том, что в структуре ВРГ и /или Н у детей, родившихся в Краснодарском крае, преобладают пороки развития мультифакториального генеза (около 68%), что соответствует данным, описанным в литературе [4]. Однако, следует отметить достаточно высокую частоту хромосомной патологии (20,24%), обнаруженной среди больных с исследуемыми ВПР, в структуре которых преобладали по частоте синдром Эдвардса и Патау. Структура моногенной патологии, обнаруженной у пациентов с ВРГ и/или Н, характеризовалась широким спектром нозологических форм (синдромов), широко описанных в мировой биомедицинской литературе.

Проведенный нами анализ ассоциации полиморфизма 3435 C/T (26 экзон) гена ABCB1 с риском развития ВРГ и/или Н показал, что в краснодарской популяции исследуемый ген не связан с риском развития ВРН, но он может быть ассоциирован с повышенным риском развития ВРГ. Полученные нами различия приближались к достоверным, но не достигали уровня статистической значимости, что, вероятнее всего, связано с малой численностью выборки больных с ВРГ. Однако мы наблюдали существенное снижение частоты носителей нормального аллеля в группе больных ВРГ. Данный ген входит в суперсемейство генов цитохромов Р450 (CYP450), которые участвуют в метаболизме ксенобиотиков, в том числе соединений, которые могут оказывать токсическое воздействие на плод [7, 13, 14, 16]. Доказано, что он экспрессируется в органах и тканях, выполняющих экскреторную или барьерную функцию, в том числе в плаценте [12, 17]. Данные, полученные другими исследователями, также обнаруживают ассоциацию исследуемого гена с повышенным риском развития ВРГ [15] Возможно, носительство вариантного аллеля данного гена может влиять на механизмы детоксикации экзогенных соединений и приводить к накоплению токсичных промежуточных метаболитов, обладающих тератогенными свойствами.

Полученные результаты позволяют определить вклад различных генетических факторов в формирование риска развития ВРГ и/или Н у детей Краснодарского края, а также оценить актуальность исследований, направленных на поиск генетических механизмов, посредством которых реализуются тератогенные эффекты ксенобиотиков.


Список использованных источников:

1. Боконбаева С.Дж., Алдашева Н.М., Лобзова А.В., Джанабилова Г.А. Врождённые пороки развития как индикатор качества состояния окружающей среды// Вестник КРСУ. 2008. Т. 8. № 4. С. 165-170.

2. Вейр Б., Анализ генетических данных. Дискретные генетические признаки. – М.: Мир, 1995.

3. Верзилина И.Н., Агарков Н.М., Чурносов М.И. Распространенность и структура врожденных аномалий развития у новорожденных детей г.Белгорода// Педиатрия.  2009 - №2. - С 151-154

4. Гуцан А.Э. Врожденные расщелины в/губы и неба. - Кишинев: Штиинца, 1980. - С. 9-12; 41-45.

5. Демикова Н.С. Мониторинг врожденных пороков развития и его значение в изучении их эпидемиологии// Рос. вестн. перинатологии и педиатрии. - 2003.- №4. - С. 13-17.

6. Крикунова, Н.И., Назаренко Л.П. Медико-генетический мониторинг ВПР у детей в Томской области// Рос. вестн. перинатологии и педиатрии. 1998; 43 (2): 56–58

7. Куценко С.А. Основы токсикологии. – СПб., 2002. - 395 с.

8. Лванга С.К., Чжо-Ек Тыэ. Обучение медицинской статистике: Двадцать конспектов лекций и семинаров. ВОЗ. - М.: Медицина, 1989. - 216 с.

9. Маниатис Т., Фрич Э., Сэмбрук Д., Баев А. Методы генетической инженерии. Молекулярное клонирование. –М.: Мир, 1984. - 479 с.

10. Реброва О.Ю. Статистический анализ медицинских данных. Применение пакета прикладных программ STATISTICA. - М.: МедиаСфера, 2002. – 312 с.

11. Фоменко И.В., Дмитриенко С.В., Касаткина А.Л. Эпидемиологическая характеристика врожденных расщелин лица на территории Волгограда и Волгоградской области// Стоматология детского возраста и профилактика.- 2009. № 1. С. 20-24.

12. Hitzl M., Schaeffeler E., Hocher B., Slowinski T., Halle H., Eichelbaum M., Kaufmann P., Fritz P., Fromm M., Schwab M. Variable expression of P-glycoprotein in the human placenta and its association with mutations of the multidrug resistance 1 gene (MDR1, ABCB1)// Pharmacogenetics: May 2004. – Vol. 14. – Iss. 5. – p. 309-318.

13. Iqbal M., Audette M.C., Petropoulos S., Gibb W., Matthews S.G. Placental drug transporters and their role in fetal protection// Placenta 2012, 33: 137–142.

14. Myllynen P., Immonen E., Kummu M., Vahakangas K. Developmental expression of drug metabolizing enzymes and transporter proteins in human placenta and fetal tissues// Expert Opin Drug Metab Toxicol, 2009, 5: 1483–1499.

15. Omoumi A, Wang Z, Yeow V, Wu-Chou YH, Chen PK, Ruczinski I, Cheng J, Cheah FS, Lee CG, Beaty TH, Chong SS. Fetal polymorphisms at the ABCB1-transporter gene locus are associated with susceptibility to non-syndromic oral cleft malformations. Eur J Hum Genet. 2013 Feb 27.

16. Prouillac C, Lecoeur S (2010) The role of the placenta in fetal exposure to xenobiotics: importance of membrane transporters and human models for transfer studies. Drug Metab Dispos 38: 1623–1635.

17. Rao V.V, Dahlheimer J.L., Bardgett M.E., Snyder, A.Z., Finch R.A., Sartorelli A.C., Piwnica-Worms D. Choroid plexus epithelial expression of MDR1 P glycoprotein and multidrug resistance-associated protein contribute to the blood-cerebrospinal-fluid drug-permeability barrier // PNAS Vol. 96, Issue 7, 3900-3905, March 30, 1999.


03.09.2013 17:27:00